Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12866D10
Clone ID IST12866D10
Vector VICTR76
Project tigm

Sequence tag IST12866D10HMF1
Sequence
GTGTGCACATTCTGAAATGTATGTAGAGGTCTGAGAATTATCTTTATGGGGTTGTTCTCTCCTTCAATTTCTTGCAGGTT
CTGCAAATTGAACTTGGGTCACTATGTTTCTACAGCAAAGCTCTTTATCTGCTGAGCCTCTCTGCAGCTCTGTTTTATTT
TTCAGATAGTATCTANTANTTTGTCTAGTCTGANNCTTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCN
Sequence Type genomic DNA
Unitrap ID UNI6642

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 90234690..90234918 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027933 (Ints3) NM_145540 integrator complex subunit 3 Gene [Source:MGI Symbol;Acc:MGI:2140050]

 
Come back to gene ENSMUSG00000027933


For any suggestions or comments, please send an email to unitrap@crg.es