Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14676C8
Clone ID IST14676C8
Vector VICTR74
Project tigm

Sequence tag IST14676C8HMR1
Sequence
NCCTCTGCCCCTTCACTTCCAAGTGCTCCTACAAAAGAAAGGTTCTGAGCTGCCTTCACGCAACCATCCAAGCCTGAGGC
TCGTGGAACACAGGCTGCTCTAAGCTCTAAGTCTCACAGGGGTTCAAGCCCAGCAGTTGCTGTTCTTCCAGAGTTCAGTT
CCTGGTACCTGCATTGGGCAGCTTACAACTGCCTANATCTCCCACTCCCGGGGGGGAGTCTGATGTCCCCTTTTCTGGCT
CCCTCNAGCAACCTCACACACATATATATAATAAGTAGTTTTTTAAAATGGTTAAACC
Sequence Type genomic DNA
Unitrap ID UNI12168

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55700553..55700848 292
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040721 (Zfhx2) NM_001039198 zinc finger homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:2686934]


Sequence tag IST14676C8BBF1
Sequence
GGCTGATCTGCCTTAAATCTGGACTCACCATCTTATTTGATCTAGGCACAGGCTATCCCCGGAGGATTCTCTGAATTTGG
AGGACTACCACAGTAAGGTCTGTTAAGTGTCCCTGGTTCTCCAATTTGATGTGAGCTTCTATGATGTAATGATGTCATTT
TAATACTATTGTAGCAGCCTTGCCTATGATCCCAGCTACTGGGAGACTGAGACAGGAGGATTATAAGCTTGAGAATGTCT
GGGCTACAGACTGTGGGGCCCTGTCTTAAAATAACAAGTGCCAAGCGGTATATGCATGTAATCCCAGCACTCCAGAGTTG
GAAACAGAAGGGCCGGGAGTTCAAAGCCNACCTTGGCTATACAGAGTTACAAAGGGATCTGGCTTACAGCTCANTANTNA
AAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55700847..55701249 395
 
EST/CDNA Est Name
  CJ128585.1 - CJ127306.1 - CJ129471.1 - CJ129634.1 - CJ127815.1 - CJ130506.1 - AU254595.1

 
Come back to gene CJ128585.1 - CJ127306.1 - CJ129471.1 - CJ129634.1 - CJ127815.1 - CJ130506.1 - AU254595.1


For any suggestions or comments, please send an email to unitrap@crg.es