Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14408D11
Clone ID IST14408D11
Vector VICTR74
Project tigm

Sequence tag IST14408D11HMR1
Sequence
CCACCTGAAGCTTAGGGNCTTTCCNAGCCTGANAGCCCTATCCAGCCNGTGTCCCTGACATGCCTTGGTCACCTGTGCCT
TAGCTTGGCCCTGTGCTTCAGGAGTTTTGAATAACAGCTGGAGGGCAGANCTGGCACCACACGGGGTGGGCTGCACATGA
CAGAANTCANTCTGCTGGGTGCTGGCANCCTGACCACAGATTTTCCTTGACAA
Sequence Type genomic DNA
Unitrap ID UNI32502

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24341791..24342002 196
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079662 (Ntn2l) NM_010947 netrin 2-like (chicken) Gene [Source:MGI Symbol;Acc:MGI:1341188]


Sequence tag IST14408D11HMF1
Sequence
GTGGGCAGTTGTGTCATCTTTGGCAAGTGAAGGGCCTGGGTTGTTGCAGGTCTCCGAGGGCAAAGGTATATGAACACTGC
TGCAATTTCGAACGAATACAGAAAGAGGATTTCCTATTCCGCAGGGACGGAAAGTGCCCCAAGGGAAGGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24341999..24342149 151
 
EST/CDNA Est Name
  BB606801.1 - BB606835.1 - CJ119629.1 - CJ107105.1 - CJ116998.1 - BB643419.1

 
Come back to gene BB606801.1 - BB606835.1 - CJ119629.1 - CJ107105.1 - CJ116998.1 - BB643419.1


For any suggestions or comments, please send an email to unitrap@crg.es