Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A067A06
Clone ID A067A06
Vector pT1betageo
Project ggtc

Sequence tag A067A06
Sequence
TGTCCAGAGCAAAGGTGACAGCATTGAGGAGATTTTGGCTGACTCTGAGGATGAGGATGAGGAAGAAGAAAGAGGCCGGG
GCAAGGAGCAGCGGAAGCTGGCACGACAGAGGAGCCGGGCATGGCTGAAGGAAGGTGGTGGCGATGAGCCCCTCAACTTC
CTGGATCCCAAGGTGGCCCATCGAGTCCTTGCCACCCAGCCTGGGCCTGGGCGGGGCAAGAAGAGGGACCATGGCTTCAA
GTTGAGTGCTGATGGCCGGCTGATCATACGGGAGGAGGAAGATGGAAACAAGGTGGAGGAAGAAGATGGCACTAAAGGTC
Sequence Type mRNA
Unitrap ID UNI11825

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 41945298..41945932 172
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035049 (Rrp12) NM_199447 ribosomal RNA processing 12 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2147437]

 
Come back to gene ENSMUSG00000035049


For any suggestions or comments, please send an email to unitrap@crg.es