Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CG0593
Clone ID CG0593
Vector pGT0lxrT2
Project sanger

Sequence tag CG0593
Sequence
ATCCCCATGTCCAGGAAGACAAGAGCCGTCCTTTCATTGCATCCAGCCCAACCAACGGGATGAAAACCATGGAGGAAGGC
TGGATCTCTTACGATCGGTTAGAGCATCCAGTAAGGGGATTTTTTTTTTTATAACTATGCCGATGACTGCTGGAATTGGA
AGATCTTCCCAAAAGCTCGATTAGTGTCTGAATATGGCTACCAGTCCTGGCCTTCTTTTAGCACACTAGAAAAG
Sequence Type mRNA
Unitrap ID UNI1683

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135214013..135214245 214
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028164 (Manba) NM_027288 mannosidase, beta A, lysosomal Gene [Source:MGI (curated);Acc:Manba-001]

 
Come back to gene ENSMUSG00000028164


For any suggestions or comments, please send an email to unitrap@crg.es