Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CF0813
Clone ID CF0813
Vector pGT0lxr
Project sanger

Sequence tag CF0813
Sequence
TGAGATCGATGCGCTGAAGAGTCTGAGACATCAGCACATATGTCAGCTCTACCATGTGCTGGAGACAAAGAACAAAATAT
TCATGGTTCTGGAGTACTGTCCAGGAGGAGAGCTGTTTGACTACATAATCTCCCAGGNATCGCCTGTCGGAAGAGGAGAC
CCGGGTCGTCTTCCGTCAGATACTGTCTGCAGTTGCGTATGTCCACAGCCAGGGCTATGCCCACAGGGACCTCAAACCAG
AAAATTTATTATTTGATGAAAATCATAAGCTAAAGCTGATTGACTTTGGTCTTTGTGCAAAACCCAAGGGCAACAAGGAC
TACCATCTGCAGACGTGCTGTGGGAGCCTTGCTTATGCAGCTCCTGAACTAATACAAGGGAAGTCGTACCTTGGATCAGA
GGCAGATGTTTGGAGCATGGGCATCCTCCTGTATGTGCTCATGTGTGGATTTCTACCATTTGATGATGATAATGTCATGG
CTTTGTACAAGAAGATAATG
Sequence Type mRNA
Unitrap ID UNI1684

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 44319885..44330994 147
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035683 (Melk) NM_010790 maternal embryonic leucine zipper kinase Gene [Source:MGI (curated);Acc:Melk-001]

 
Come back to gene ENSMUSG00000035683


For any suggestions or comments, please send an email to unitrap@crg.es