Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14720B4
Clone ID IST14720B4
Vector VICTR76
Project tigm

Sequence tag IST14720B4HMR1
Sequence
TTTAAAACTGGGCCCATCTGGCCCTATCTTTTGTCTGACTTTCTAAGGAACATTTTC
Sequence Type genomic DNA
Unitrap ID UNI4014

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35525661..35525716 56
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041408 (Wapal) NM_001004436 wings apart-like homolog (Drosophila) Gene [Source:MGI (curated);Acc:Wapal-001]


Sequence tag IST14720B4BBF1
Sequence
AAACTACAAAGGAACACTGAAAAGTAGTGGTAGAAATATTTCAAAATTGAAACCACAACTAATCTTACATTAGTTTCTTC
AAAGACCCAGAAGCAATCTTAATTGCAAATCAAGGTAGCCAACATTCCAAGAAAAATGCAACCTTCCAAGCATTGAAGGT
AAGTTTGGCTAATTATTATAAAAACACTGCCTTAGCAACAGACAGGGGTAAGGAGGAGTTGAGTGTAAAGTAGGCAGAGC
AAGCAGTTCTCTCTGATTCAGCACAGGCACGACAGCTGCAAAAAGTGGGAAGCAGAGAAATTGGTATCCAGAAATCAGAA
ACAGGTTGTCATTTCACCAGAATTTACACCACAATTTCNNAATATCAATTCCTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35525283..35525663 377
NO GENE  


Sequence tag IST14720B4HMF1
Sequence
AAACTACAAAGGAACACTGAAAAGTAGTGGTAGAAATATTTCAAAATTGAAACCACAACTAATCTTACATTAGTTTCTTC
AAAGACCCAGAAGCAATCTTAATTGCAAATCAAGGTAGCCAACATTCCAAGAAAAATGCAACCTTCCAAGCATTGAAGGT
AAGTTTGGCTAATTATTATAAAAACACTGCCTTAGCAACAGACAGGGGTAAGGAGGAGTTGAGTGTAAAGTAGGCAGAGC
AAGCAGTTCTCTCTGATTCAGCACAGGCACGACAGCTGCAAAAAGTGGGAAGCAAANAAATTGGTATCCANAAATCNNAA
ACAGGTTGTCNNTTNACCNNAATTTACACNNCANTTTCCAAATATCAATTCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35525292..35525663 346
NO GENE  

 
Come back to gene ENSMUSG00000041408


For any suggestions or comments, please send an email to unitrap@crg.es