Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A064F04
Clone ID A064F04
Vector pT1betageo
Project ggtc

Sequence tag A064F04
Sequence
CGTCATGTCTAAGTCCGAGTCTCCCAAGGAGCCAGAACAGCTGCGGAAGCTCTTCATCGGAGGGCTGAGCTTCGAAACAA
CCGACGAGAGTCTGAGGAGCCATTTTGAGCAATGGGGAACACTAACAGACTGTGT
Sequence Type mRNA
Unitrap ID UNI10804 UNI11836

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 27757141..27757275 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046636 (AC102562.13)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 123599180..123599314 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058922 (AC165425.2)  

 
Come back to gene ENSMUSG00000058922


For any suggestions or comments, please send an email to unitrap@crg.es