Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A063C01
Clone ID A063C01
Vector pT1betageo
Project ggtc

Sequence tag A063C01
Sequence
CGNNNNGCCATNCNNNACCTCACATCCCATTCCTTTTCTGCAGTGGGCTCCTCTCCCCAAACCTGCTCTGATCTCCTGGC
TAGAAGCCAGGAAGCCATGGGGCGTGAACATCTGCACGGTTCAGCTTAAGAGAGATGCTGATGCTGCGCCTGAAGGTG
Sequence Type mRNA
Unitrap ID UNI11840

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 122763822..122763962 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047036 (Zfp445) NM_173364 zinc finger protein 445 Gene [Source:MGI Symbol;Acc:MGI:2143340]

 
Come back to gene ENSMUSG00000047036


For any suggestions or comments, please send an email to unitrap@crg.es