Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12499C10
Clone ID IST12499C10
Vector VICTR76
Project tigm

Sequence tag IST12499C10BBF1
Sequence
ACAAGTATTAGTAAAGTTCGTTTTCCACCCGCGCTTATCTCCATGTTTGGTGATAAAAGAATTGGCCTAAATTTGGTTGT
TTTGTTTTGCAAGTTTTTTGTTTTGTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI6430

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 7569579..7569695 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024759 (5730596K20Rik) NM_146091 atlastin GTPase 3 Gene [Source:MGI Symbol;Acc:MGI:1924270]


Sequence tag IST12499C10HMF1
Sequence
ACAANNNNNAGTAAANNNNNTTTTCCACCCGCGCTTATCTCCATGTTTGGTGATAAAAGAATTGGCCTAAATTTGGTTGT
TTTGTTTTGCAAGTTTTTTGTTTTGTTTTTTTTTTTTNNANNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000024759


For any suggestions or comments, please send an email to unitrap@crg.es