Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P112A09
Clone ID P112A09
Vector FlipROSAbetageo
Project ggtc

Sequence tag P112A09
Sequence
TGTTCTCCAGGAACACATCCAGCACTCCAGGATTTCATCCAGTGTCATG
Sequence Type mRNA
Unitrap ID UNI11841

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3169018..3169057 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054753 (AU018091) NM_001004153 cationic amino acid transporter 5 [Source:RefSeq peptide;Acc:NP_001004153]

 
Come back to gene ENSMUSG00000054753


For any suggestions or comments, please send an email to unitrap@crg.es