Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CF0769
Clone ID CF0769
Vector pGT0lxr
Project sanger

Sequence tag CF0769
Sequence
TTGACAAGGATGAAATCATCAAGTTGTATAGCTGTATCATTGGCAACATGATTTCGCTATTTCAGATAGAGAGCTTGGCC
CGGGAGGCCTCCACTGGAGTACTGAAAGACCTGATGCAGGGACTGATCACCTTAATGCTGGATTCTCGGATTGAAGATCT
GGAGGAAGGACAACAGGTGATTCGTTCTGTGAACCTCTTGGTGGTGAAGGTTTTGGAGAAATCAGACCAGACCAATATCC
TCAGTGCCGTGCTTGTTTTACTTCAGGACAGCCTGCTAGCAACATGGTAGTTTTCCCAAAGTCTTTTTTTTTTTTTTTGG
AACAGCTGGACAACCGAGACCAAGGAGCGCCAGGCAGC
Sequence Type mRNA
Unitrap ID UNI1688

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91446529..91452955 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040549 (Ckap5) NM_029437 cytoskeleton associated protein 5 Gene [Source:MGI (curated);Acc:Ckap5-001]

 
Come back to gene ENSMUSG00000040549


For any suggestions or comments, please send an email to unitrap@crg.es