Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P110D02
Clone ID P110D02
Vector FlipROSAbetageo
Project ggtc

Sequence tag P110D02
Sequence
TAGCTCCTCGGCGGTGTACTGGGGTGCGTGGAGGCTGTAGTCACGGTGGCGCCCGCGGGGACGGAGGAGGGAATGAGTGA
AGAGGATCAGGGCTCCGGCACTACTACAGGCTGCGGGCTGCCCAG
Sequence Type mRNA
Unitrap ID UNI11843

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 102348909..102349033 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023051 (Tarbp2) NM_009319 TAR (HIV) RNA binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:103027]

 
Come back to gene ENSMUSG00000023051


For any suggestions or comments, please send an email to unitrap@crg.es