Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14865E5
Clone ID IST14865E5
Vector VICTR76
Project tigm

Sequence tag IST14865E5BBF1
Sequence
AGATCCCATTACAGATGGTTGTGAGCCACCATGTGT
Sequence Type genomic DNA
Unitrap ID UNI32524 UNI32525 UNI32526 UNI32527 UNI32528

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 38267371..38267406 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 66163914..66163949 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061950 (Ppp4r1) NM_146081 protein phosphatase 4, regulatory subunit 1 Gene [Source:MGI Symbol;Acc:MGI:1917601]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 55954014..55954049 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 38960457..38960492 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 36010966..36011001 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 18605979..18606014 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 37576964..37576999 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 43444312..43444347 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55778423..55778458 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 116259012..116259047 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 96721719..96721754 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 31637494..31637529 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 35064592..35064627 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066571 (4931406P16Rik) NM_172741 RIKEN cDNA 4931406P16 gene Gene [Source:MGI Symbol;Acc:MGI:1924311]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 104490370..104490405 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029310 (Nudt9) NM_028794 nudix (nucleoside diphosphate linked moiety X)-type motif 9 Gene [Source:MGI (curated);Acc:Nudt9-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57500993..57501028 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038729 (Akap2) NM_009649 A kinase (PRKA) anchor protein 2 Gene [Source:MGI (curated);Acc:Akap2-005]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 11175923..11175958 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 5583548..5583583 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 69494330..69494365 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063145 (Bbs5) NM_028284 Bardet-Biedl syndrome 5 (human) Gene [Source:MGI (curated);Acc:Bbs5-003]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 51546788..51546823 36
NO GENE  


Sequence tag IST14865E5HMR1
Sequence
TNNGATGNNCTTTTCTGGTGATTNTGAAGACAATGACNGTGTATTCAAGTGTGTGTGTGTGTGTGTGNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14865E5HMF1
Sequence
AGATCCCATTACAGATGGTTGTGAGCCACCATGTGGTTGCTGGGAATTGAACTCAGGACCTCTGGAAAAGCAGCCATTGC
TCTTAACTGCTGAGTCATCTCTCCAGCCCCATTTAGCCATTTTTGTTTGTTTGTTTGTTTGGTTGGTTGGTTTTTGGTTT
NTNGANACANGGTNNCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 125078044..125078216 165
NO GENE  

 
Come back to gene ENSMUSG00000063145


For any suggestions or comments, please send an email to unitrap@crg.es