Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13043A9
Clone ID IST13043A9
Vector VICTR76
Project tigm

Sequence tag IST13043A9HMR1
Sequence
CTGGGCTTGAGATTGTCAAGTACAGGCNACATCTCTTCCTGGATCCATCTGCCNTTATCAGCCCTCCTCCTCCTCATGTT
TGTGTANAGTGGGCTTGTACAGGCCATGGTGCTAGTACAGAGTTCAGAGATAAACTTTCAGGAGTCACTTCTTTCCTTCT
ATCTTTATGTGACTTCCAGGGACTGAACTCANATCATTANCCTTGGTGGCNATGCTTTTTTTTTTNTC
Sequence Type genomic DNA
Unitrap ID UNI20220

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 37339646..37339870 213
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001946 (Esam) NM_027102 endothelial cell-specific adhesion molecule Gene [Source:MGI Symbol;Acc:MGI:1916774]

 
Come back to gene ENSMUSG00000001946


For any suggestions or comments, please send an email to unitrap@crg.es