Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P108G05
Clone ID P108G05
Vector FlipROSAbetageo
Project ggtc

Sequence tag P108G05
Sequence
GGGGGGGCGCTCCCAGTTCTGGTCGCGAGCTGAGGCCGCGCGGGTTGTGAGGAGAGGTCTGGTTTGCGCGCGCTGCGCGG
ACCACCGAAGCTACCTGACGCGGGCGCCGCCGAAGTGGAAGTCGGAGCGGGAGTTTTTGTTTGTGAAGGGCGGCCGCGAG
GCCTGAGGCTAACGTCAGGCTGAGGAGAGCGCCGCGCG
Sequence Type mRNA
Unitrap ID UNI11845

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52650879..52651067 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063511 (Snrp70) NM_009224 U1 small nuclear ribonucleoprotein polypeptide A Gene [Source:MGI Symbol;Acc:MGI:98341]

 
Come back to gene ENSMUSG00000063511


For any suggestions or comments, please send an email to unitrap@crg.es