Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0159
Clone ID GC0159
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0159
Sequence
CTTCCAACATTCGCAGTTGCCGCTGCCGCTGCAGCTCTTGTGGGTTGAGTGACGTGTTGCGGGCTGACAGCAGGTAGAGA
TAGGCACCGTCTCCATTCCGCCGAATGCCGTGTGAATGCAAGGTCTCCTGGTCTCGTGCCAGCCTCTGTCCAACCACCCA
CTGCTGCAGGCTAGGTGGGAAGCCATAGTCCAGGAATACCATGTCCTTAAGGGAGGCCACTGTCATATCCGGGCGTACTG
TGAGCCAAATGGTGACGGTGTGCAT
Sequence Type mRNA
Unitrap ID UNI163

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152151952..152153048 200
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027466 (Rbck1) NM_001083921 RanBP-type and C3HC4-type zinc finger containing 1 Gene [Source:MGI (curated);Acc:Rbck1-002]

 
Come back to gene ENSMUSG00000027466


For any suggestions or comments, please send an email to unitrap@crg.es