Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15093H3
Clone ID IST15093H3
Vector VICTR80
Project tigm

Sequence tag IST15093H3BBF1
Sequence
CAAACAAGAAAAACAAGCAAACAAACAAACAACCCAATCAACCAGGTATAAAGTGCTGCTAATATACTTCCTGTTTCTGA
GCTTCACTTCTAAATGAAGCTCAATAAGGAAGGCCCACCCTGCGAAGAAATACAAAGTGTTCTTCACTTAGAGGGAGAGC
TCTGAAGCCATCCAATCTCGCTGGCAGCTGAGAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI15532

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12591103..12668334 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031010 (Usp9x) NM_009481 ubiquitin specific peptidase 9, X chromosome Gene [Source:MGI (curated);Acc:Usp9x-001]


Sequence tag IST15093H3HMF1
Sequence
CAAACAAGAAAAACAAGCAAACAAACAAACAACCCAATCAACCAGGTATAAAGTGCTGCTAATATACTTCCTGTTTCTGA
GCTTCACTTCTAAATGAAGCTCAATAAGGAAGGCCCACCCTGCGAAGAAATACAAAGTGTTCTTCACTTAGAGGGAGAGC
TCTGAAGCCATCCAATCTCGCTGGCAGCTGAGAGATCTTGGAGAAACCACTGACCTTGAGCTATAAAATGTAGCAAGGTA
GCTAACTTTGCAAGACAGGGCTTCTTTGTCTTTGTTATTAACAAAGTTTCCAAAGGAAAGCTGAGCCCCACCCACCTCCT
CTGGGTGCCCTTCACTCANCTATTGTAACCNTTCTACATTTCTCATTGTTTCTGTTGCCNGTGAGAACCCATTTGGAAAC
TGATTTCACCTNGCCNNNTCTACCNNNAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12591103..12591525 401
NO GENE  

 
Come back to gene ENSMUSG00000031010


For any suggestions or comments, please send an email to unitrap@crg.es