Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11387A10
Clone ID IST11387A10
Vector VICTR76
Project tigm

Sequence tag IST11387A10BBF1
Sequence
CAGTCATCACCCGGTCTANCCTATAGAATTGGAAGCAGAATAGCAAACTCTCTCTCTTTAGGTGCCCCCAAAGACAAGCT
CATATTACCTCGTTGAAGGGTTGCATTTATATGCGTAAACTATGGAGGACTGAGGAACCTTCTAGCCTGTGAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI18497

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 122135443..122135599 155
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028121 (Bcar3) NM_013867 breast cancer anti-estrogen resistance 3 Gene [Source:MGI Symbol;Acc:MGI:1352501]


Sequence tag IST11387A10HMR1
Sequence
NTGTTACAACCTGCAGAATGGCTGTGATCCCAGGGGGTGCAGGCCAACCCAGGCCAGGTCCCTGGAAGACAATTTCTCTC
CCCAGTGAACAAGAGCAACTAGGAATTCTCTGGTGTGCATATCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 122135322..122135444 123
NO GENE  


Sequence tag IST11387A10HMF1
Sequence
CAGTCNTNACCCGGTCTAGCCTATANAATTGGAAGCAGAATAGCAAACTCTCTCTCTNNANGTGCCCCCAAAGACAAGCT
CATATTACCTCNTTGAANGGTTGCATTNATATGCGTAANCTATGGAGGACTGNNGAACCTTCTAGCCTGTGAGATCTANA
GTTAGAGATTCCCCTGCAAATAGATATCANANCANANTGACTCTTGTAGTCNNAATAACCNNNANCAGGGACAANNNNNA
GGCCNNNNTTNNNATNCCTACTTCTGCCNAGTATTANCCNNNTGACTGGANGAAATTTTGAATTATGAAATTGGTTTGAA
AATAAGCCACCCNGGGGCATGCTGTGATGGTNAGTTGGTCTCAAAACGCGTCCCTNAACATCAGCNNTCTAGCTTTCCGC
ANTGAAGCCTGGGCCACCCGCTGGGCACCTGCTCTGANNANGTNACAGACNCTCNNANCTCTNACCTNNTCACTAGCNGC
CNNTTNCNTGNCTGCTCTGCACTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000028121


For any suggestions or comments, please send an email to unitrap@crg.es