Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A071C02
Clone ID A071C02
Vector pT1betageo
Project ggtc

Sequence tag A071C02
Sequence
TTTTATTTCAGGAGGATCATCCTAGGAGGCCNNNGGCGAGGCCCAAAAATGGCCGATTAGCTTTNNNNAATGTAGCAACT
CAGGGAGTTCATTTATGGGANNNNCAAGACAGAGTTTTAGTAAGGAAATATCAAGGTGTTACCCAAGGGTTTTATACAAT
CCACTCGTGTTTTGGAGGCCATAATGAAGACTTCATTGCTAGTGGCAGCGAAGATCACAAGGTTTACATCTGGCACAAAC
GTAGTGAACTGCCAATTGCGGAGCTCACAGGGCACACGCGCACAGTAAATTGTGTTAGCTGGAACCCACAGATTCCATCC
ATGATGGCCAGTGCCTCAGACGATGGCACTGTTAGAATATGGGGACCAGCACCTTTCATACACCACCAGAATATTGAAG
Sequence Type mRNA
Unitrap ID UNI11851

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 183111435..183113932 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038733 (Wdr26) NM_145514 WD repeat domain 26 Gene [Source:MGI Symbol;Acc:MGI:1923825]

 
Come back to gene ENSMUSG00000038733


For any suggestions or comments, please send an email to unitrap@crg.es