Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A071B04
Clone ID A071B04
Vector pT1betageo
Project ggtc

Sequence tag A071B04
Sequence
GAGAAGGGATTTTTATCTCCTTCATCCTTGCTGGCGGACCTGCTGATCTAAGTGGAGAGCTCAGAAAAGGAGATCGCATC
ATATCGGTGAACAGTGTTGACCTCAGAGCTG
Sequence Type mRNA
Unitrap ID UNI5069

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 31812825..31829576 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022770 (Dlg1) NM_007862 discs, large homolog 1 (Drosophila) Gene [Source:MGI (curated);Acc:Dlg1-002]

 
Come back to gene ENSMUSG00000022770


For any suggestions or comments, please send an email to unitrap@crg.es