Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11263F10
Clone ID IST11263F10
Vector VICTR76
Project tigm

Sequence tag IST11263F10HMR1
Sequence
NGGCAGAGCTTTCCTGAGGGGCTTGCTGCAAGACTACTGTTAAGATTGTGGATCTAGATTCTGTTTCATTGTCCGTTAAA
ACTTCTCAC
Sequence Type genomic DNA
Unitrap ID UNI25340

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 105045808..105045894 87
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020694 (Tlk2) NP_036033 tousled-like kinase 2 (Arabidopsis) Gene [Source:MGI (curated);Acc:Tlk2-001]


Sequence tag IST11263F10BBF1
Sequence
CCCTTAACAGAAGCACAGTCTCCCAACNAACACTTAAATAGACTACAGGAATGACTGGCGGATTCTCAAAGTTCACTGGA
CCCCGTGACAAATCTCCCCTGCAACCTATCAGTCTGTTTTCTAGCACANAAACTCTTCTGTGCAACTCCTAAATGTGTTG
AAGTTATCCTCTGAAATGCTCATTATCGCTGAATAACTCACCTTACTTACACCAACTCCANTGAACCTGGCCTCTANTAA
TTCCTGCCTTCGNGGGTCCAGGCTATGCANTTCTTCCATNATTTCTACNGAAAAAGAANNANGGACAAGAAGCCNTGANA
ACTAACTGAAAAGAAAAAAGTTTTGTGTAAAACAAAACACACAGTANTTTTGTAAACCTCAAGGAAATACACATTCAAGT
GCTATAAGTNATCTGATGTCATCAACAGTTATCTAAGATTCCGTAGCAGTTCNAGTTCTCACCTACNANGATCNNTTCTA
CTTTTCCTGAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11263F10HMF1
Sequence
ATCTCATTAGTTAGTTGGTTAGTTTTTGCTACGCTCTCTGGTCGAGTCAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 40396409..40396459 51
NO GENE  

 
Come back to gene ENSMUSG00000020694


For any suggestions or comments, please send an email to unitrap@crg.es