Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14259G8
Clone ID IST14259G8
Vector VICTR74
Project tigm

Sequence tag IST14259G8HMR1
Sequence
CCCTCAAATTTAAATATTCNATATTCTGGACCAACTCTTCTACAGAAAGTTGATTTTCTTCTTTAAGAGCAGAGATAAAC
AAGAATAGTAAGTCAGCAGAAATCAAATTAATAGCTTATTTTATAGTGTTATAAACCCTACCCTGTGCCAAATGTCANAT
TTCTATTGAAAAATAACACTGTTTCAGTGGACATACTGTGAATCTGTGCTTGTAAAGAGTCACTAGCTTGCCACACACAG
CAGGGAAGTGATATACATGTTGCCTTCTGTCTCCCTTTATCTTGTTGGCTTCTGGTTTNNNTGTTGCTGTTGGGGGGCGG
GGAAAGCANCANGTTTGTATCTTTTN
Sequence Type genomic DNA
Unitrap ID UNI31689

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 138010655..138010999 331
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040268 (Plekha1) NM_133942 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 Gene [Source:MGI (curated);Acc:Plekha1-002]


Sequence tag IST14259G8BBF1
Sequence
AGGGAAAATGGTTTGCCACAAGTTTGTTGGTAAGATAAACTAAGACGCACTGTATTCAAAATTCGTGTTACTATTTTTGA
AATAATAGTTCATCTCCAGCTGTAAACTAAAAATGGTTTTTCATTTTACTTCCAAAGCGTCTGAGTCACTTAACACTCTT
CTAAACTTCGCTACAGATTCGTCCAGTGGCCGTCAACGTAAAAAGCCTGGAAGCTANANAGCANATCACTCTNCANTCTT
AANACAATGGTATAAACCTTGGAGTGNGCNANTTGTTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 138010381..138010658 260
 
EST/CDNA Est Name
  CF616345.1 - BF466147.1 - BM939919.1


Sequence tag IST14259G8HMF1
Sequence
AGGGAAAATGGTTTGCCACAAGTTTGTTGGTAAGATAAACTAAGACGCACTGTATTCAAAATTCGTGTTACTATTTTTGA
AATAATAGTTCATCTCCAGCTGTAAACTAAAAATGGTTTTTCATTTTACTTCCAAAGCGTCTGAGTCACTTAACACTCTT
CTAAACTTCGCTACAGATTCGTCCAGTGGCCGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 138010465..138010658 194
 
EST/CDNA Est Name
  CF616345.1

 
Come back to gene CF616345.1


For any suggestions or comments, please send an email to unitrap@crg.es