Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A070F07
Clone ID A070F07
Vector pT1betageo
Project ggtc

Sequence tag A070F07
Sequence
CCGGGTCGGATTCGTGACATGATGGGACTAACAGATGACAGGGACATATCCGAGACTGTGAGTGAGACCTGGAGCACTGA
TGTCCTGGGAAGTGACTTCGACCCGAACGTTGATGAAGATCGTTTGCAAGAGATTGCAGGTGCAGCAGCAGAGAACGTGT
TAGGTAGTTTGCTGTGCCTTCCAGGTTCAGGGTCAATTCTACCTTGGGCCTTGTCGGTGTGTTGTTCAGTAGCAGAGCTC
CACAAATCAAGTCTGGTAGGTGTCCAGTGCTACTTCCAAGTAACTCAG
Sequence Type mRNA
Unitrap ID UNI9401

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 34564632..34567815 133
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026867 (Gapvd1) NM_025709 GTPase activating protein and VPS9 domains 1 Gene [Source:MGI (curated);Acc:Gapvd1-001]

 
Come back to gene ENSMUSG00000026867


For any suggestions or comments, please send an email to unitrap@crg.es