Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A070D02
Clone ID A070D02
Vector pT1betageo
Project ggtc

Sequence tag A070D02
Sequence
TATAAGTTTTTCTCCCTTTCTTCTGTGGATAAGCTGGAACAGATCTATGAATGCA
Sequence Type mRNA
Unitrap ID UNI11858

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 143114184..143114238 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029578 (Wipi2) NM_178398 WD repeat domain, phosphoinositide interacting 2 Gene [Source:MGI (curated);Acc:Wipi2-001]

 
Come back to gene ENSMUSG00000029578


For any suggestions or comments, please send an email to unitrap@crg.es