Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A070A08
Clone ID A070A08
Vector pT1betageo
Project ggtc

Sequence tag A070A08
Sequence
CTTGTTCCTACTAGTGTCGCCAGGACCTTTTCACCGCCTGCAGGCTATCATGGAAAAAGAGGGCCCTCGCTCGTTGTTTA
GAGGATTGGGCCCCAATTTGGTGGGGGTTGCTCCCTCCAGAGCAATATACTTTTCTGCCTTATTCAAACAGCAAGGAAGA
GTCGTAATGGTGTTTTTCATCCNNNTTTTACTCCAGTTCACATTCTTCATCTTCAAGNCCAG
Sequence Type mRNA
Unitrap ID UNI6264

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 8963543..8963821 75
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000082953 (AL929440.5)  

 
Come back to gene ENSMUSG00000082953


For any suggestions or comments, please send an email to unitrap@crg.es