Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A069C02
Clone ID A069C02
Vector pT1betageo
Project ggtc

Sequence tag A069C02
Sequence
GTCGGAAGACTTTGGAGCTTGGATTTAGCGGCTTGCGGGGTCTGTTCGCCTTGCGCTTTCAGTGGAACAGGAAAACATGA
TGAGTGATTTCGGTGAAGAGTTGACAAAGCTGGCTGTGGCAGAGGATAACCCAGAAACGTCGGTGCTCTCTAAAACGGGA
ATGCATTTCCCATGGCTTCACAAGCACGTTGAAGCTGTAG
Sequence Type mRNA
Unitrap ID UNI6265

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165754: 362363..364392 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072258 (Taf1a) NP_067441 TATA box binding protein (Tbp)-associated factor, RNA polymerase I, A Gene [Source:MGI Symbol;Acc:MGI:109578]

 
Come back to gene ENSMUSG00000072258


For any suggestions or comments, please send an email to unitrap@crg.es