Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14181G8
Clone ID IST14181G8
Vector VICTR74
Project tigm

Sequence tag IST14181G8BBF1
Sequence
CCTACAGGGGAGACTAAGGAGCCAGATGAATGGGGAAAGGGAGGCAGCCTCTTAATCCTTTTGTCTGTAGCTCCATCTTT
GGAAATGCTGAGTAATTAATCAATTGTTAAAGGGCTTTCTGCCGAATTCTGGGGAAAGCCTTTACTTTTAATGAGCTGCT
ANTCTGTCTCTTCAGTGCTGGGAATGAGTCTAGAGCCACCTGTCTCCTANGCNAACACTTTACTGCTAAACTACTAAGCT
CTGCTCCCCNACACTCCGGGTTANCCTTTACATCTGTATCTGTCTGCCTNNGTTGNNANTTCANGTGTGTNCCNNCCCCN
GNNCTNNTNANTGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14181G8HMF1
Sequence
CCTACAGGGGANACTAANGAGCCANATGAATGGGGAAAGGGAGGCANCCTCTTAATCCTTTTGTCTGTANCTCCATCTTT
GGAAATGCTGAGTAATTAATCAATTGTTAAAGGGCTTTCTGCCGAATTCTGGGGAAAGCCTTTACTTTTAATGAGCTGCT
AGTCTGTCTCTTCAGTGCTGGGAATGANTCTANAGCCACCTGTCTCCTANGCAAACACTTTACTGCTAAACTACTAAGCT
CTGCTCCCCCACACTCCGGGTTAGCCTTTACATCTGTATCTGTCTGCCTCTGTTGGGATTTCAGGTGTGTGCCACCCCCT
GTGCTCCTCAGTGTATTTCTACAGGGTGGTGGTACCTAAGGAAAAATCCATTCCTANGGACTCTGACGTAAATATTTGGG
ATGANGTCTGTCNNGGACTGGGCATTTTNNCTTCNCTTATTTTTATANCCCTGN
Sequence Type genomic DNA
Unitrap ID UNI9027

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109145486..109145938 421
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000303 (Cdh1) NM_009864 fizzy/cell division cycle 20 related 1 (Drosophila) Gene [Source:MGI (curated);Acc:Cdh1-001]


Sequence tag IST14181G8HMR1
Sequence
GGTTNACCTCACCCTTCCACCCACTACCCTAGCCTGCCTTTCTAAACCTCAGTCTCCTGTTTGTAAAGAGGGGCAGAAAG
GACTGCAGCAATAAAGGAATTGGACGTGGGACGCCCCCTGTCTCATCTCAATCCTTTGTCTCCTCCGCATTGGACCTATT
GATTGCTATTGATTGATTCTGCATAATCTGCCTCTCCTCCCCACCTGATGCCAGGAGGAACAGGTTGCCCACATTTTCAC
AGGGGACTCTGCANACTCTCTGGGCTGGTGCANGATGGGCTGTTGNGTACNCTTAANNGTGAACAGAANCCGGGCANTGG
TGGCNCACACCTTTAATCCCAGCACTCGGGANGCANANGCAGGCNNANTTCTGANTTCAAGGCCNGCCTGGTCTATAAAG
TGGGTTTCNNNATNNNCNNGGCTATNCNANAAACCCTGTCTNNNAAAACCCAAAATAAATAANNNANTAANTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000000303


For any suggestions or comments, please send an email to unitrap@crg.es