Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12641G6
Clone ID IST12641G6
Vector VICTR76
Project tigm

Sequence tag IST12641G6BBF1
Sequence
NAGCCTAGTATATAAAATGAAGGCCTGGTTACAAGATAGAATCTGTCTTGTCAAGTTGGGTCCCTTCAGCTGAAAAGTGT
ANTGTTTTGGAGACACCAAACTGTGTTTTCTGTCTGACCCAAGACACAAGGCTGAAGTTAGAGCAGTCTTCTGGGACAGA
GGTTCTTAACCCGTGGGTCTGTATTAACTCANTCTAAGATAGAACTGTANAGCATCTANATGGTAAGGAAGAATTGGCTA
CTGTTTTTGAANAGGGCACACAGTCCCANCTCACAGGAGAAATGAGGTTAACCCCCTTTCANCCTAGGTGGAAAGGGATC
T
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30766092..30766410 303
 
EST/CDNA Est Name
  CF578656.1 - BI465466.1


Sequence tag IST12641G6HMF1
Sequence
ATCCGATTTTAAGGGCTCAGAGCCAGAAATCAACAGAAGGGGATTTAGTCTCACAAAGAAGCTGGGGTACTAGAAGACAT
TAGATATTTGTACTAGAAGACATGTAGATGTTTGAAAACAGGTTTTAAAAAATTAGCATTCTATGCAGGGCAGTGGTGGC
ACACGCCTTTAATCCCAGCACTTGGGAGGAAGAGGCAGGCGGATTTCTGAGTTCNAGGCCAGCCTGGTCTACAAAGTGAG
TTCCAGGACAGCCAGGGCTACNCANANAAACCTTNTTGAG
Sequence Type genomic DNA
Unitrap ID UNI32541

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 76643817..76644095 269
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051747 (Ttn) NM_011652 titin Gene [Source:MGI (curated);Acc:Ttn-019]

 
Come back to gene ENSMUSG00000051747


For any suggestions or comments, please send an email to unitrap@crg.es