Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13583E9
Clone ID IST13583E9
Vector VICTR74
Project tigm

Sequence tag IST13583E9BBF1
Sequence
GGTAAGAGCACCCGACTGCTCTTCCAAAGGTCCAGAGTTCAAATCCCANCAACCACATGGTGGCTCACAACCATCCGTAA
CAAGATCTGTCN
Sequence Type genomic DNA
Unitrap ID UNI26585

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 41963806..41963894 87
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 51854789..51854877 87
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 23162531..23162619 87
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 18619070..18619158 87
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 61034798..61034886 87
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 93920037..93920125 87
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 43861824..43861912 87
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 58498933..58499021 87
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 8247800..8247888 87
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3273252..3273340 87
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005534 (Insr) NM_010568 insulin receptor Gene [Source:MGI (curated);Acc:Insr-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 13585328..13585416 87
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 147476022..147476110 87
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 107781430..107781518 87
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 74661486..74661574 87
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7259276..7259364 87
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 8824228..8824316 87
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 9764050..9764138 87
NO GENE  


Sequence tag IST13583E9HMF2
Sequence
TTTTGATGCTGANTGACTGTGTGACACAGGANATTGACCCTGANAGGCTGTGTGAGGCNGGGGGANGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000005534


For any suggestions or comments, please send an email to unitrap@crg.es