Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14757G2
Clone ID IST14757G2
Vector VICTR76
Project tigm

Sequence tag IST14757G2HMR1
Sequence
AGAGGTGTTATGTGTTATTAATTTTAAATATAAATAGTAAATAGAAAGTAATCAAAATGTTTATTGAATGGATAGGTGTT
CTTTTATCANGTACCTACCTTTCANAAAATCAGGTACCATGACAAAACTGACATAGCAAGAGTTC
Sequence Type genomic DNA
Unitrap ID UNI14684

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 32916395..32916538 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014932 (Yes1) NM_009535 Yamaguchi sarcoma viral (v-yes) oncogene homolog 1 Gene [Source:MGI Symbol;Acc:MGI:99147]


Sequence tag IST14757G2HMF1
Sequence
CTCTCAGAACATTAAAATAACATAAAAATCAAGAACATTTGGAAGTGTGTGGTATTTTCTTTTTTTTTAACTTTTTTTTA
TTANATTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 32916310..32916398 87
NO GENE  


Sequence tag IST14757G2BBF1
Sequence
GGGGGTCANTGTCNTTCCCGCTACNCCGCTANACTTCNCTGGCCTCCCGGGTCCTGATTCANGGGACCCTGANAGCGCGG
GATCGGGAGGCTGCGGACACGGGACACNANANACANCGCCTGAAAACGAGGGACCCGCAGGAAATCATGTTTCGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000014932


For any suggestions or comments, please send an email to unitrap@crg.es