Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11057G11
Clone ID IST11057G11
Vector VICTR76
Project tigm

Sequence tag IST11057G11BBF1
Sequence
AGAACACTGACTGCTCTTCCNAAGGTCCTGAGTTCAATTCCCAGCAACCACATGGTGGCTCACAACCATCTGTAA

Sequence Type genomic DNA
Unitrap ID UNI32545 UNI32546

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29583954..29584028 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 85184287..85184361 73
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 33764145..33764219 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053519 (Kcnip1) NM_027398 Kv channel-interacting protein 1 Gene [Source:MGI (curated);Acc:Kcnip1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 78408359..78408433 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049624 (Slc17a5) NM_172773 solute carrier family 17 (anion/sugar transporter), member 5 Gene [Source:MGI (curated);Acc:Slc17a5-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 156586092..156586166 73
NO GENE  

 
Come back to gene ENSMUSG00000049624


For any suggestions or comments, please send an email to unitrap@crg.es