Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A068D07
Clone ID A068D07
Vector pT1betageo
Project ggtc

Sequence tag A068D07
Sequence
TCCCCCGTNNNCTCCGGCGCGTTCGGCAATTTCCGTCGGGCCCTGGCCGCCATTTTCTCGCCGCTTGTGTGGCTCGCTGG
CTGCGTGGCTCGGTTCTTGGGAGCGAAGCTTTGTCCGGTTCGGCAATGGACGGAATTGTCACTGAGGTTGCTGTTGGTGT
GAAGAGAGGATCTGACGAGCTACTCTCAGGCAGTGTTCTCAGCAGCCCCAACTCTAATATGAGTGGCATGGTAGTTACAG
GT
Sequence Type mRNA
Unitrap ID UNI5621

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 119464619..119486250 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028134 (Ptbp2) NM_019550 polypyrimidine tract binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:1860489]

 
Come back to gene ENSMUSG00000028134


For any suggestions or comments, please send an email to unitrap@crg.es