Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A068C04
Clone ID A068C04
Vector pT1betageo
Project ggtc

Sequence tag A068C04
Sequence
CAGAGCCCTGCTACTTCTCATTCTAATAAAGTGGCTCAGAAATGCAAGAGGAATAATAAGAAGCCTAAACCTGAAGAGAG
GCCAGGTGTGATCCGAGAGGTCATGATCATAGAGGTCAGTTCAAATGAGGAGGAAGAAAGTACCACTTCAGAGAACGAAA
ATGTGGAAAGCTGGATGCTCCTGGGGTCTGAGGAAGATGGTAAAGACAATGACATCCTTCTCAACTTGGTGGGGTGTGAG
ACCGCTGGTGCTGAAGG
Sequence Type mRNA
Unitrap ID UNI11872

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 44775091..44775347 257
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035649 (Zcchc7) NM_177027 zinc finger, CCHC domain containing 7 Gene [Source:MGI (curated);Acc:Zcchc7-003]

 
Come back to gene ENSMUSG00000035649


For any suggestions or comments, please send an email to unitrap@crg.es