Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12506A6
Clone ID IST12506A6
Vector VICTR76
Project tigm

Sequence tag IST12506A6HMF1
Sequence
ACAGGAGACAGTGGATTCGACCACGAGGCTTGGAAGCTAGGGGTTTTTATAGAAAAGGAGTGGGGCTGGGGGAGGAATTG
GCGCGGTTTCACATGATTGGTCCATTTAAACATCAGCTGTAACATTTAACTTAGGTCAGAGGGGTANGANATNNGGNGGC
NANNGN
Sequence Type genomic DNA
Unitrap ID UNI3595

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 31863285..31863444 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001855 (Nup214) NM_172268 nucleoporin 214 Gene [Source:MGI (curated);Acc:Nup214-001]

 
Come back to gene ENSMUSG00000001855


For any suggestions or comments, please send an email to unitrap@crg.es