Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14764E6
Clone ID IST14764E6
Vector VICTR76
Project tigm

Sequence tag IST14764E6BBF1
Sequence
NNNTAATATATAAAGAACTCTTCAAGTCAACAACAACAACAGGCACAGGGCTTCAGTAAACATTTCTCTGAGAAACAATA
TGCAAAGATGCAGACCATTCCTCACCACCAGAGATGCAAATCCAAGCTATAGTCAGGTGCAGCCAGCACCACTAACCCTG
AGAACCACAGGAAAAGAGCAGGTGCTGGGGACATGTGGAGAGACCACAGCCCTGGGCAGCACGGGTGCGGTCACTTCAGA
AAACAATACACAGGCTTTTCCAAAACTTAAAAGGCTGGCTAGCGATATTGCTAATGGGTGTCACATATATCTGAGGGGAA
GGCAGAATTTGAAGAAGATATATATATATTGTCCTCTTCCTCTGGCTTTTGGAAACAGGTTTCCTCTATGTAGCCCTGGC
TGTCCTANAACTTTCTCTGCNNGCCAGGCTGACCTCAAACCCANANATCTGTCG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 8998605..8999054 440
 
EST/CDNA Est Name
  BQ928977.1 - BE283395.1 - BY739098.1 - BY738731.1 - BY740782.1 - BQ961012.1 - CJ136141.1 - CJ136617.1 - CX731631.1 - BY743833.1 - BY739762.1 - BY745110.1 - CX231257.1 - BY744508.1 - CK030620.1 - BY739698.1 - BE914013.1 - BF535102.1 - BY705659.1 - BQ936210


Sequence tag IST14764E6HMR1
Sequence
GGGTGTCTCTGCGTGTGCGGCAGGGCTGTGGGGGCGCCCCTGGTCTAGGTCATGCCTTCTGCCCTTTTCCTTGGCTCGCC
TTGGCTGAGGTGTCCCTGTANTGGCGAAAGTCACAGTACGGTGGCTAGGTGGCTTTCGTCCATAATTCTCTGGGTTTGTG
TTC
Sequence Type genomic DNA
Unitrap ID UNI16469

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 30994752..30994912 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027660 (Skil) NM_011386 SKI-like Gene [Source:MGI (curated);Acc:Skil-001]

 
Come back to gene ENSMUSG00000027660


For any suggestions or comments, please send an email to unitrap@crg.es