Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13167C5
Clone ID IST13167C5
Vector VICTR74
Project tigm

Sequence tag IST13167C5BBF1
Sequence
CTTTTGCTGTTTGACAGTGTCTTGCTGTGAGCTTAAGCTGGCCTTGAACTCATCTTTCTGCCTTGGCTCTAGTACTGAAT
CCCAGGCATGTGTTACCATATTCAACTCACAGGAACTTAAAAATAGCATTTGCTCTTATCTGATTGAAGAACTAACATGT
ATGTAACCTGCATGTTTTATATTCTGAAATATATGGAGATATATAATGAACTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI32555

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46311218..46311439 222
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023953 (Polh) NM_030715 polymerase (DNA directed), eta (RAD 30 related) Gene [Source:MGI Symbol;Acc:MGI:1891457]

 
Come back to gene ENSMUSG00000023953


For any suggestions or comments, please send an email to unitrap@crg.es