Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12265C1
Clone ID IST12265C1
Vector VICTR76
Project tigm

Sequence tag IST12265C1BBF1
Sequence
CCAGCAACCACATGGTGGCTCACGACCATCTGTAA
Sequence Type genomic DNA
Unitrap ID UNI18211 UNI25955 UNI29896 UNI32556 UNI32557

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 28206775..28206809 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 34837605..34837639 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24280820..24280854 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 11298590..11298624 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 72874268..72874302 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047921 (Trappc9) NM_029640 trafficking protein particle complex 9 Gene [Source:MGI Symbol;Acc:MGI:1923760]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 51895009..51895043 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 21455810..21455844 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3282401..3282435 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020451 (Limk2) NM_001034030 LIM motif-containing protein kinase 2 Gene [Source:MGI (curated);Acc:Limk2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21281502..21281536 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033335 (Dnm2) NP_001034609 dynamin 2 Gene [Source:MGI Symbol;Acc:MGI:109547]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 9151548..9151582 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62029385..62029419 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036955 (2510003E04Rik) NM_028197 RIKEN cDNA 2510003E04 gene Gene [Source:MGI Symbol;Acc:MGI:1919570]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 11650685..11650719 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28415689..28415723 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 31147337..31147371 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029166 (Mapre3) NM_133350 microtubule-associated protein, RP/EB family, member 3 Gene [Source:MGI (curated);Acc:Mapre3-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 134340328..134340362 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 63497226..63497260 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7737660..7737694 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 28322966..28323000 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 16052994..16053028 35
NO GENE  


Sequence tag IST12265C1HMF2
Sequence
CCAGCAACCACATGGTGGCTCACGACCATCTGTAATGGGATCCGATGCCCTCTTCTGGTGTGTCTGAAGAGAGCAATGGT
GTACTCATATGCATAAAATAAATAAACAAATCTTTAAAAAAAACAAAATAAAAATAAATAAATAAAAATAAATTCAATGT
TTAAAAACCATAAGATTTATGAATATTTAAGATCTGTACAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAA
GAAGAAGAAGAAGAAGAAGAAGAAGAAGAANACAACANCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35735735..35736011 273
NO GENE  

 
Come back to gene ENSMUSG00000029166


For any suggestions or comments, please send an email to unitrap@crg.es