Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12039A9
Clone ID IST12039A9
Vector VICTR76
Project tigm

Sequence tag IST12039A9HMF2
Sequence
GAGGGATGACTGTGTGTGATTTTCTGAGGCAGTGGGATGACTGTGAGTGATTTTCTGANTCNTGGAGATGACNGTGAGTG
ATTTTCTGAGGCAGGGGGATGACTGTGAGTGATTTTCTGAGGCNGGGGGATGAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 166441778..166441910 125
NO GENE  


Sequence tag IST12039A9BBF1
Sequence
AACCCAAAGGCCCTGAAAAGCTATCCATTGGCCCTGTTGGCCTCCCTCCAGCCAGGTAGTGCTGGGGTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI27131

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104155314..104155389 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]

 
Come back to gene ENSMUSG00000018411


For any suggestions or comments, please send an email to unitrap@crg.es