Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CF0701
Clone ID CF0701
Vector pGT0lxr
Project sanger

Sequence tag CF0701
Sequence
AAAAGGTTATGTGGCGAACACGCTGGATCTTCTGAGGAAGCAAATACTAGGAATAGAATCTTGTGTCCTTTAGATCCAAA
ACACACAGTGTATGAAGACCAACTAGCAAAACATTNGAAAAAATGTAATTCAAGAGAGAAGCCTAAGCCNGANNNNCNNN
ANNCNNNATTGGTGTGAGGGTTTTTTTAAAGGGTTTTTTTTTTTTTTTGTATATAGGTTCCATTTTCTTCTCTATCTGAA
GAGCAGTTGGAGAACTTAATTAAGAAATTGAGAAAAGCAAGTGAAGGCTTGAATTCTACACATGAAGATCACATCATGTC
CCATCCAGCATTGCATGATGCCCTTAATGACCCAAGGAATGGCGATTGTGCAGTCAAACACCTGAAACAGCAG
Sequence Type mRNA
Unitrap ID UNI1698

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 116292409..116295435 110
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033439 (Ccdc76) NM_030016 coiled-coil domain containing 76 Gene [Source:MGI Symbol;Acc:MGI:1925219]

 
Come back to gene ENSMUSG00000033439


For any suggestions or comments, please send an email to unitrap@crg.es