Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P091D03
Clone ID P091D03
Vector FlipROSAbetageo
Project ggtc

Sequence tag P091D03
Sequence
CTCCCTTCCCAGCGCTCCTTTCTCCCCGGCGATCGCCACCGCTTCCTGGAACAGAGACGCCCTTCGTCGGCTCCCTGCGG
GTGACCGAGGCAAGAACCACAGCTGGTTGTGTGCAGAGGCCAGCCGCCACTACT
Sequence Type mRNA
Unitrap ID UNI10881

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 98011351..98011484 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041773 (Enc1) NM_007930 ectodermal-neural cortex 1 Gene [Source:MGI Symbol;Acc:MGI:109610]

 
Come back to gene ENSMUSG00000041773


For any suggestions or comments, please send an email to unitrap@crg.es