Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13648D9
Clone ID IST13648D9
Vector VICTR74
Project tigm

Sequence tag IST13648D9HMR1
Sequence
GGCACCAGGGCTGAAGGCCCAGANTGTCCACCTCAGGTGTCTGAATCTAAGGGGACCTTGGCTCCACCAGTGTCGAGTTG
TCTGTCGGATGCTTGTCACCTTGGCATCCGTGTGATCCTCTGAGAGGCCTGGCTGCCAACATGGGCCTCTGCTTAATTGC
AGAGTGACTCCTTGACCTTGCAGACCCTCANCATCTTTCTCCACGGAGTGTACAATGGTAGCGCCTCANAAAGCTATCCC
TCGGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 10307424..10307669 240
NO GENE  


Sequence tag IST13648D9BBF1
Sequence
GTGCCCTGGCCACCTTGAGTTCAGATCNGCCCACCCTGTCCCTGGCCACGTGGCTGACGGGATTTCCGCCATGTTTGGGG
TATGAATTGACAAGTACTCCATTGACGGGGGCAGGGGAGGGGGTAGGCAGGGCACAANACTCCCACTGTGTTGTGTCTCC
ACCCTCCCCACCCGCCAGGACAATGGCCTANACTCNNCCAGCAGCCACANCTGTGGGGGGTGGNGN
Sequence Type genomic DNA
Unitrap ID UNI15384

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 10307206..10307428 211
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036098 (Gm98) gene model 98, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2684944]

 
Come back to gene ENSMUSG00000036098


For any suggestions or comments, please send an email to unitrap@crg.es