Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12278A2
Clone ID IST12278A2
Vector VICTR76
Project tigm

Sequence tag IST12278A2BBF1
Sequence
CCCCGCACCGTGTCTCCACCTTCCCCAGGCTGCGCCTGTCCCCCAGCCCTACCTCGCAGCGCAGCCGTGGCCGCGCCTCC
TCCCACTCATCCCAGTCTCAGGGTGGAGGCAGCGTCACCAAAAAGCGCAAGCTGGAGTCTTCCGAGAGCCGGAGCAGCTT
CTCGCAGCATGCTCGCACTAGCGGGCGTGTGGCGGTAGAGGAAGTCGATGAAGAGGGAAAGTTCGTGCGGCTGCGCAACA
AGTCCAACGAGGTGGGCCTGTGAACCAGGGTGGTCTTTTCAGTGGCTGGGAGTTCTTGGTTCTCGTGGANCATCTGTCTC
CCTATCTGANAATTTGGAGTGTGTGGTAGTCCTGTCATCTTTAAATTGTTGGGAAGATGCATGATATAGGGGATGGGTGA
CCCTTGANCCNATAGTCTANGTTTGAATGCCAGANGTAGTGGTGGCAANCCNGTCTTTCTTTTCTTTTTCTTTTTCTTTT
TCTTTTC
Sequence Type genomic DNA
Unitrap ID UNI32565

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88288303..88288787 466
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028063 (Lmna) NM_019390 lamin A Gene [Source:MGI (curated);Acc:Lmna-001]


Sequence tag IST12278A2HMF1
Sequence
CCCCGCACCGTGTCTCCACCTTCCCCAGGCTGCGCCTGTCCCCCAGCCCTACCTCGCAGCGCAGCCGTGGCCGCGCCTCC
TCCCACTCATCCCAGTCTCAGGGTGGAGGCAGCGTCACCAAAAAGCGCAAGCTGGAGTCTTCCGAGAGCCGGAGCAGCTT
CTCGCAGCATGCTCGCACTAGCGGGCGTGTGGCGGTAGAGGAAGTCGATGAAGAGGGAAAGTTCGTGCGGCTGCGCAACA
AGTCCAACGAGGTGGGCCTGTGAACCAGGGTGGTCTTTTCAGTGGCTGGGAGTTCTTGGTTCTCGTGGAGCATCTGTCTC
CCTATCTGANAATTTGGAGTGTGTGGTAGTCCTGTCATCTTTAAATTGTTGGGAAGATGCATGATATAGGGATGGGTGAC
CCTTGAGCCAATAGTCTANGTTTTGAATGCCAGANGTAGTGGTGGCAAGCCTGTCTTTCTTTTCTTTTTCTTTTTCTTTT
TCTTTT
Sequence Type genomic DNA
Unitrap ID UNI32565

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88288303..88288787 476
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028063 (Lmna) NM_019390 lamin A Gene [Source:MGI (curated);Acc:Lmna-001]

 
Come back to gene ENSMUSG00000028063


For any suggestions or comments, please send an email to unitrap@crg.es