Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0161
Clone ID GC0161
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0161
Sequence
CTCCCTGAAGAGTCTCTGCTTCTTTGTCCCCACTAACTGATCCCGAAATCATGTTCACATGATGCGTCTGCTGGGTCAGG
TATTCCTGGAAATCTTTTACAAAGTCCAAAGGCTCTGGTTTCTTTTCACCCATCTTGGTGC
Sequence Type mRNA
Unitrap ID UNI165

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 138540183..138540323 141
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040167 (Ikzf5) NM_175115 IKAROS family zinc finger 5 Gene [Source:MGI (curated);Acc:Ikzf5-001]

 
Come back to gene ENSMUSG00000040167


For any suggestions or comments, please send an email to unitrap@crg.es