Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CF0694
Clone ID CF0694
Vector pGT0lxr
Project sanger

Sequence tag CF0694
Sequence
AGCTCGACTTGAAGTGGAAAACCAAGCTAAGCGTCTGCTGGAGCAAGGTGTGGAGACCCAG
Sequence Type mRNA
Unitrap ID UNI1582

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 32445782..32445842 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035933 (Cog5) component of oligomeric golgi complex 5 Gene [Source:MGI Symbol;Acc:MGI:2145130]

 
Come back to gene ENSMUSG00000035933


For any suggestions or comments, please send an email to unitrap@crg.es