Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15029C8
Clone ID IST15029C8
Vector VICTR78
Project tigm

Sequence tag IST15029C8HMR1
Sequence
NGGTATCGGTGAATTTCTTATCCTTCTGCCTCTATTTCCTGANAGCTAGGATTACAGGCCTGTGTGTTATCTTCCGAACC
TGGTGTTACATTCCTGAAAATGGAACTCANGGTTTCTAGCAAGCACTCCAGCAACTAAGCTACATTTTTAGCCCCTTGCA
GTTGTTTGAACGTTTAAACAGGTTCTAGAAGAGAGGGGATGGAAGTAGTTTGGGTTCTACCTTAACAAAACTTANANGAC
NTTGCTTTAATTGCCCCCCCCCCNNTTA
Sequence Type genomic DNA
Unitrap ID UNI1144

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108533946..108534207 252
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000064145 (Arih2) NM_011790 ariadne homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1344361]


Sequence tag IST15029C8BBF1
Sequence
CCCTTGGTTGCATATAAGTTTAGAGTGTAGCCTGTGTTATAAGCCGTTCTGCCTAAAACAAACAAAAGCCACAAAAGTCA
TTCAGGAAGTATCTATGGAAAACCTCTTACTTAGGCAGTCACTACCAACCTGAATCTCCCCCCTTTTATTACTTTTTTTT
TCCCTTTCNAATGCTGGTCAAAACCTAAGGAGGANACTTTGANCTTCCTTATTCTGCCTCTAAAGCCCCACCCACTCTGC
CNTGTGGCTCATCTCTGAAATGTCTTANCTCANGTNNCNNGGATTTCCNGCTTTCNCNACCAGGTATCTATCACANNAAC
ANTCNNTNNACCACACNCNNNNNNTTTTCNCNNCNNAANCCTTTTGACCAGGCCCCGANANTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000064145


For any suggestions or comments, please send an email to unitrap@crg.es