Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M046F03
Clone ID M046F03
Vector U3betageo
Project ggtc

Sequence tag M046F03
Sequence
TGCCTCCCCCTTCCATGATGGACTGTACTCTGAAACTAGACTCTAC
Sequence Type mRNA
Unitrap ID UNI11062

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108498346..108498382 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]

 
Come back to gene ENSMUSG00000029267


For any suggestions or comments, please send an email to unitrap@crg.es