Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M045C05
Clone ID M045C05
Vector U3betageo
Project ggtc

Sequence tag M045C05
Sequence
ACGGGAGATGGAGTCGGCCACCTCAGGTACGCGGGCCGGGAGGAGG
Sequence Type mRNA
Unitrap ID UNI221

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134185838..134185883 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030677 (Kif22) NM_145588 kinesin family member 22 Gene [Source:MGI Symbol;Acc:MGI:109233]

 
Come back to gene ENSMUSG00000030677


For any suggestions or comments, please send an email to unitrap@crg.es