Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CF0683
Clone ID CF0683
Vector pGT0lxr
Project sanger

Sequence tag CF0683
Sequence
ATGAACCTTAATGAAGAAAAGAAAGCTCCTTTGCGAAAGAATGGATTTTAGCATCAAGCGTGAGATGGTTGTCCATGTAT
ATTTTTGCTACTTCCAAATCTATAGTTGGAAGTAAAGTTCTG
Sequence Type mRNA
Unitrap ID UNI1703

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 126355781..126360483 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034480 (Diap2) NM_017398 diaphanous homolog 2 (Drosophila) Gene [Source:MGI (curated);Acc:Diap2-001]

 
Come back to gene ENSMUSG00000034480


For any suggestions or comments, please send an email to unitrap@crg.es