Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14643G12
Clone ID IST14643G12
Vector VICTR74
Project tigm

Sequence tag IST14643G12BBF1
Sequence
ATTTCAAGATTTTCAAACAGTCTGACTAATCTAATGGCAGGAGACAAAACTGCTCCTGTTTGACATCATGATAAAGGATA
CCATGAGATGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 30859882..30859975 94
NO GENE  


Sequence tag IST14643G12HMR1
Sequence
AAATCTTCTCTTTCTTTTTCTCTTCCCGTTTCCN
Sequence Type genomic DNA
Unitrap ID UNI14180

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 30859972..30860004 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047412 (CT025653.7-201) NM_172765 Zinc finger and BTB domain-containing protein 44 (BTB/POZ domain-containing protein 15) [Source:UniProtKB/Swiss-Prot;Acc:Q8R0A2]

 
Come back to gene ENSMUSG00000047412


For any suggestions or comments, please send an email to unitrap@crg.es